-->
@IlDiavolo
valuable scientific information
This is exactly what others here have explained to you that which you lack any understanding. What I don't get is why you keep coming back here to humiliate yourself?
valuable scientific information
32 days later
I mean new genetic information should be created because an arm is totally different to a wing.
But trees don't have a mechanism to read those tree rings and then use the infomation obtained. The DNA in a cell is read by ribosomes that click along it 3 bases at a time, grabbing the amino acid corresponding to the codon read and adding it to the protein coded for. There's a bit more to it than passively indicting an annual cycle of growth.DNA contains information in the same sense as tree rings.
1.) Strawmen: “if Evolution is true, why have we never seen a Crocoduck”, “why have we never seen a fly turn into not a fly” and similar aims at ridiculing evolution.
2.) Equivocation: “DNA contains information”, “evolution is just a theory/new information cannot be created”.
3.) Showing one thing - no matter how small - that isn’t fully explained by evolution - disproves evolution. Showing one thing - no matter how small - that is partially explained by creationism - proves creationism.
But trees don't have a mechanism to read those tree rings and then use the infomation obtained. The DNA in a cell is read by ribosomes that click along it 3 bases at a time, grabbing the amino acid corresponding to the codon read and adding it to the protein coded for. There's a bit more to it than passively indicting an annual cycle of growth.
What do you mean by 'genetic information'? DNA is a molecule, so do you mean that a specimen with a longer DNA molecule has 'more genetic information' than a specimin with a shorter DNA molecule?
It's a common creationist argument that DNA contains information, and information by definition implies conscious intent, therefore DNA encoding must be by conscious intent.
The problem with this argument lies in its second premise. Information does not require a conscious mind to create. A prefect example is tree rings. Tree rings contain information about the age of a tree and past climate conditions. Do they require a conscious mind to create? Nope.DNA contains information in the same sense as tree rings.
Do they require a conscious mind to create? Nope.
Information, in the strict sense is merely a collection or pattern of things.
Bear in mind that what the tree rings express can only be deciphered by us, concious and intelligent beings.
No. I'm saying that a specimen like an alligator has different "genetic information" than a bird. According to the article I provided, the alligator doesn't have the genetic information to develope feathers, that is why the scientists couldn't induce scales to become feathers. It's clear to me that the physical characteristics of a specimen are contained in the DNA, in this sense the DNA contains "information". Don't you agree?
My point was that there are plenty of examples of information that do not require a conscious mind to create.
I don't think you'd wait for an experiment that demonstrated macro-evolution directly to run its course! I don't know how many generations arereuired to achieve the level of body-form change you'd call macro-evolution to occur but its probably 'lots'! Time scales are enormous - do you reaise that early dinosaurs such as plateosaurus (c250 MYr ago) are more distant in time from tyrannosaurus rex (c. 70 MYr ago) than tyranosaurus rex is from us?But feel free to show me what I requested. That would put an end to this thread and I will go with the tail between the legs.
This "information" is a string of molecules attached to eachother creating one larger molecule called a DNA molecule.For example the binary sequence "10011001 11010010 00111001 10000100 00111001" contains information.In the same way the DNA sequence "AAGCGTCGAAGCTGGGGCTGAATACCATAAAGG" contains information. Each letter here is a molecule that is part of the DNA chain.So, how can we tell which DNA molecules contain more information and which contain less?
Yes, but just because it requires a conscious mind to interpret abstract meaning from information does not mean that it takes a conscious mind to create information.
If you watch the program "Ancient Alliens" in History Channel, you will determine this program is more believable than the stories scientists keep telling us about how species evolved out of nothing