IlDiavolo

Population growth leads to move taxpayers and more GDP and more tax revenue.

We shouldn’t fund wars either.  War is legalized mass murder.  Every war mongering politician needs a tall tree and a short rope if you know what I mean.  The tree of liberty must be refreshed with the blood of tyrants like Joe Brandon, Barack Obama, and Donald Trump.  Sic semper tyrannis.

The evidence overwhelmed me even after a single book is what I am saying.  The observed facts and predicted side effects of the mechanisms involved.  Anyone who seriously makes these claims I would normally say they simply need to read a book or two.

You, however, are leaning on an argument that seems similar to a 'god/alien of the gaps' argument.  You are objecting perhaps more to abiogenesis or life before the first cell.  On this there is not a lot of great experimentation published.  Enough to convince myself particularly since, as Stronn pointed out.  There is no evidence that a mind intervened.  We know that from one cell humans can form in nine months via natural processes.  A self replicating molecule is entirely likely the original start.  From there it would just need environmental/selection pressures to change for the better.

There is no need at this point to point to a higher being to initiate this. 

In which case you are no longer discussing evolution because the mechanism is defined in the Theory.

You don't believe that evolution occurred, you want to believe that a god created false evidence to fool mankind into believing evolution occurred, but it was god creating all along. Of course the bible from which your god originates informs you that this is simply untrue, your god tells you that he created all living things exactly as you see them today. Your speculations call your god a liar.

That's what we all do, so stop your complaining. Your lies and contradictions are being pointed out, that is what this forum is about. The real problem is that you hate others pointing out your lies and contradictions, so you throw hissy fits and complain of being harrassed. Of course, that's another obvious lie considering you post responses to me and the others you complain about. YOU are the actual troll here.

Of course you would say that, you're a Christian, Archy.

Yes, the evidence for evolution is so overwhelming that it takes a deeply ingrained belief system to reject it.

California was a Spanish colony for centuries before Anglos came. Not sure where you find humor in that. 

i love Mexico.  I’ve been to Guadalajara, Chitzen Itza, Puerto Vallarta, Baja, Juarez. Seems  like you are just pretending at provocation. 

thats not at all clear to me. Here in Denver, street vendors are seen as a cheap venue for experimental entrepreneurship. They facilitate all kinds temporary events. We have a number of peak seasons here - rodeo, skiing, beer fest, weed fest which were really difficult to staff and produce consistently. Street vendors suddenly offer all kinds of services, mostly food that make these event consistently fun. 

I suppose scoflawry of taxes is probably likelier given the transient nature of street markets but really, how can you tell?  Tax dodging is extremely common in the volatile restaurant industry (hell I once helped smuggle a genuine Picasso out of a very fancy restaurant that had been shut down by the taxman that morning).  I’m sure you’re right insofar as some tax dodging is very likely but I haven’t heard govts complain much. Perhaps it’s all still thought of as small potatoes or gravy. 

Yes, but just because it requires a conscious mind to interpret abstract meaning from information does not mean that it takes a conscious mind to create information.

This "information" is a string of molecules attached to eachother creating one larger molecule called a DNA molecule.

For example the binary sequence "10011001 11010010 00111001 10000100 00111001" contains information.

In the same way the DNA sequence "AAGCGTCGAAGCTGGGGCTGAATACCATAAAGG" contains information. Each letter here is a molecule that is part of the DNA chain.

So, how can we tell which DNA molecules contain more information and which contain less?

Information, in the strict sense is merely a collection or pattern of things.

 Do they require a conscious mind to create? Nope.

It's a common creationist argument that DNA contains information, and information by definition implies conscious intent, therefore DNA encoding must be by conscious intent.

The problem with this argument lies in its second premise. Information does not require a conscious mind to create. A prefect example is tree rings. Tree rings contain information about the age of a tree and past climate conditions. Do they require a conscious mind to create? Nope.

DNA contains information in the same sense as tree rings.

What do you mean by 'genetic information'? DNA is a molecule, so do you mean that a specimen with a longer DNA molecule has 'more genetic information' than a specimin with a shorter DNA molecule?

Nevertheless, morality is an expression of your feelings, so I'm not overly concerned with what you feel about this.

Prove it.

This is a non-starter because I already don't agree with the implications of your morality, in that it's just your feelings. There isn't anything substantive to build upon, when you use your feelings like this. In other words, you're arguing from pathos.

These are not intersubjectively accepted definition, at least on a global scale (i.e. dictionary usage), but I'll argue the semantics rather than the attribution of semantics to particular words, so that we can have a worthwhile discussion.

What do you mean precisely by "take advantage?" What's the context to this?

Please provide sufficient evidence to demonstrate that occurrence of this is happening "exponentially"; several anecdotes are insufficient to argue a macro-societal rule.

Lol you're actually attempting to demonise persuasion? Not to mention the fact that "evil" is a loaded term, but lets consider some examples:

What of the man who goes to concerts with his shirt off, showing his chiselled body? Is that "evil" manipulation? It's manipulation, but it's good in that he gets to show off what he has, and girls get to enjoy looking at it (and perhaps pursuing it further).

What of the child with large levels of neoteny? Is he/she "evil" for manipulating his/her parents through a sense of helplessness?

What of me when I give classroom rewards to a child for pro-social behaviour? Am I "evil" for manipulating him/her into doing societally beneficial things?

Your criticism of women is non-unique -- the entire world constantly engages in manipulation. Your argument is inconsistent because it only targets women's methods of persuasion.

Ha alright. Enjoy having no fulfilling relationships and dying alone without a legacy.

But what I've suggested isn't borrowed from stereotypes, but rather constructed on my own. All Mgtows I've seen are not attractive. A lot of them are balding. I've seen plenty with poor facial adiposity. I've never looked at a Mgtow and thought, "Damn, women are missing out on that". I think it's inductively sane to say there is a chance these men are Mgtows not by self-determined volition, but because women rejected them.

That's not accurate, albeit it would only be a part of feminism either way. Women enjoy being treated as sex objects, but only by attractive men. That's why we bother so much with clothes and makeup. It's quite annoying to have a constant slew of unattractive men catcall or hit on you, unless you've got a fragile ego or low self-esteem. It's also REALLY annoying to have an unattractive guy continue to hit on you, despite your polite attempts to tell him you're not interested. To give you some perspective, it would be like gay men approaching you in a flirty way -- you're not attracted to them, but they're attracted to you. It's slightly amusing and awkward the first time; it's downright infuriating the 1000th time.

So you acknowledge you're a hypocrite. Fantastic.

I think Mgtow is largely comprised of men whom wouldn't have a chance with women anyway. In fact, and I'm not saying that Mgtows cannot be attractive, but I've never seen a Mgtow whom I thought was attractive. Just a funny coincidence, don't you think?